Tag: School

A Protein Composed of carbs!

A Protein Composed of carbs!

Today was a fun day in Biology. I got to bring Jelly Beans to class.

The reason for this was because we were making a Jelly Bean Necklace. We did this because it helped us learn about Protein Synthesis. Protein Synthesis starts with DNA. Then Transcription occurs and we get an mRNA strand. That mRNA strand gets translated into amino acids.

 

In the necklace jelly beans are the specific amino acids spelling out a message.

 

  1. I got #29 which is this DNA sequence

DNA Sequence:

3′ TACTAAAGAACCATCTTAATAATCCTAATCACAGTATTAAGATACATCTAA

AGAATCTACCGACCATAAACAATCCTAAGAATCTTTTAACCAGTAACCATC 5′

or more neatly organized for codons

DNA Sequence:

3′ TAC-TAA-AGA-ACC-ATC-TTA-ATA-ATC-CTA-ATC-ACA-GTA-TTA-AGA-TAC-ATC-TAA

AGA-ATC-TAC-CGA-CCA-TAA-ACA-ATC-CTA-AGA-ATC-TTT-TAA-CCA-GTA-ACC-ATC 5′

2. This DNA sequence translates into the mRNA sequence of:

5′ AUGAUUUCUUGGUAGAAUUAUUAGGAUUAGUGUCAUAAUUCUAUGUAGAUU

UCUUAGAUGGCUGGUAUUUGUUAGGAUUCUUAGAAAAUUGGUCAUUGGUAG 3′

or more organized

5′ AUG-AUU-UCU-UGG-UAG-AAU-UAU-UAG-GAU-UAG-UGU-CAU-AAU-UCU-AUG-UAG-AUU

UCU-UAG-AUG-GCU-GGU-AUU-UGU-UAG-GAU-UCU-UAG-AAA-AUU-GGU-CAU-UGG-UAG 3′

3. For this project I used a variety of resources to translate this code:

CodonTableAminoAcid
4. I used a key for each jelly bean and amino acid
The message is
Mist at a Chasm is Magic as Light
WIN_20170329_23_45_28_ProWIN_20170329_23_45_40_Pro

 

5. And here is the final product

WIN_20170329_23_47_04_ProWIN_20170329_23_45_56_Pro

 

 

Conclusion:

I had a lot of fun making and modeling Protein Synthesis and it really helped me nail the concept down. Since I already took a quiz on translating the DNA sequence ti really helped on the project. I modeled Transcription by creating the mRNA sequence which was pretty easy. I modeled Translation by choosing the correct jelly beans which was hard because I had to look at the codons, find the amino acid, add to the key, poke a hole and push it through.

There are a lot of mutations that could occur, like if I put the wrong jelly bean and these mutations can also occur in humans. Some proteins could be completely messed up but it won’t have a huge impact on Life on Earth because the unaffected DNA code will be passed down. If there is a mutation in the DNA however, then life on Earth will be severely affected because a mutation will be passed down.

Lunar New Year 2017

Lunar New Year 2017

Just yesterday I attended a Lunar New Year Festival at my school. It was really fun because I learned a lot about Chinese culture. I attended a similar event like this a few months ago when I attended a Diwali Festival at my school.  After I came in, I saw a game where we had to move MNM’s from bowl to bowl with chopsticks which was impossible for me. Then I bought my ticket and looked around. I saw a lot of my friends there and almost every student from the Mandarin classes was there. I also saw a bunch of teachers like the Mandarin teacher, Mr. Yu and my Biology teacher Mr. Wong. I got a selfie with them. Then I went around, talked to my friends and learned how to write Large in Chinese. Then the shows started and I learned a lot about the culture. I saw the dragon dance  and I learned how them spreading Lettuce was the spreading of good luck. There was a lot of different activities and I learned a lot but the favorite thing that I learned was how to properly eat with chopsticks. A lot of my friends also sang two songs in Mandarin which was very entertaining.

 

img_2605

 

This slideshow requires JavaScript.

 

I also wanted to talk about the significance of cultural events to mankind.

We celebrate cultural events because they are related to tradition. It helps us remember who we are and what are ancestors had to go through. It also lets us connect to our culture. There are different festivals that allow us to have fun and celebrate . These celebrations has allowed us to see the evolution. For Chinese New Year in particular, after fireworks were invented things have changed. It allowed us to change how we celebrated and it affected culture.

We can meet up with family and reminisce on tradition or what happened during the past year of the festival. It gives us a chance to be social and interact with friends and family. It also strengthens the sense of community and allows you to connect with people from your country or religion.

Celebrations help us connect with evolution because it lets us see how a certain event has changed over the ages and it is how mankind keeps memories and tradition throughout the ages.

Meeting up with family and friends to celebrate our cultural heritage during celebrations is important and I am very glad I went to the Lunar New Year celebration so that I could learn more about Chinese culture.

 

 

Strawberry DNA Extraction

Strawberry DNA Extraction

Recently we had another lab in our Biology class which was very cool. It was a Strawberry DNA extraction Lab.

 

dna-extraction

img_2228

 

This lab was very cool and our teacher decided to postpone the test for it which was great. I saw this lab under the files section of Canvas for a while now and was wondering when we would work on it.

 

During the lab we mashed up a Strawberry and added a buffer which we created to it. The buffer got rid of everything except the DNA. Then we used a gauze and transfers the remains of the Strawberry into a test tube. We added alcohol to the test tube and spun it and DNA came out. Now this lab is very cool because it works for almost any fruit but it works best for Strawberries.

 

During this time we were studying Mitosis and the reason that this ab relates to Mitosis is that Mitosis involves DNA replication and right now we are studying the shape and how DNA gets replicated so this helped a lot.

 

THERE WERE A FEW QUESTIONS ON THE WORKSHEET WHICH I ANSWERED ON THE FILE.

This slideshow requires JavaScript.

Mitosis Lab

Mitosis Lab

mitosis-lab

Recently we have had a lab in our Biology class about Mitosis. Recently we have been talking about Cancer because it is caused when there is no restriction point in the cell cycle. Just a few days ago, we had a lab where we observed plant and animal cells during Mitosis and it was fascinating. I have put my Lab sheet above. I have taken a lot of pictures because there were so many different cells so if you want to see them all here is a link.

https://drive.google.com/open?id=0B3Ms6kR8LvWZNU1CLVVxckZocVU

I learned a lot from this lab and one of the most important was the difference between plant and animal cells dividing. When I was in 6th grade, I took an earth Science course, in 7th a physics based course and in 8th an introduction to Biology course so I have already studied Mitosis. But one thing that I did not know was that there was a difference between plan and animal cell mitosis. I also thought it was very cool how we were able to see how long each part of mitosis took. In my worksheet I calculated it and that really gave me a better idea of mitosis. I also realized how hard it is to determine which cell is in what phase because between interphase and prophase or between metaphase and anaphase it was hard to tell the difference. I really liked this lab because it gave me better insight into the cell cycle and the different phases of Mitosis.

img_2141

Here is a slideshow of 27 different pictures I have taken.

This slideshow requires JavaScript.

Most of the details about the experiment will be in the lab sheet.