Tag: Biology

A Protein Composed of carbs!

A Protein Composed of carbs!

Today was a fun day in Biology. I got to bring Jelly Beans to class.

The reason for this was because we were making a Jelly Bean Necklace. We did this because it helped us learn about Protein Synthesis. Protein Synthesis starts with DNA. Then Transcription occurs and we get an mRNA strand. That mRNA strand gets translated into amino acids.

 

In the necklace jelly beans are the specific amino acids spelling out a message.

 

  1. I got #29 which is this DNA sequence

DNA Sequence:

3′ TACTAAAGAACCATCTTAATAATCCTAATCACAGTATTAAGATACATCTAA

AGAATCTACCGACCATAAACAATCCTAAGAATCTTTTAACCAGTAACCATC 5′

or more neatly organized for codons

DNA Sequence:

3′ TAC-TAA-AGA-ACC-ATC-TTA-ATA-ATC-CTA-ATC-ACA-GTA-TTA-AGA-TAC-ATC-TAA

AGA-ATC-TAC-CGA-CCA-TAA-ACA-ATC-CTA-AGA-ATC-TTT-TAA-CCA-GTA-ACC-ATC 5′

2. This DNA sequence translates into the mRNA sequence of:

5′ AUGAUUUCUUGGUAGAAUUAUUAGGAUUAGUGUCAUAAUUCUAUGUAGAUU

UCUUAGAUGGCUGGUAUUUGUUAGGAUUCUUAGAAAAUUGGUCAUUGGUAG 3′

or more organized

5′ AUG-AUU-UCU-UGG-UAG-AAU-UAU-UAG-GAU-UAG-UGU-CAU-AAU-UCU-AUG-UAG-AUU

UCU-UAG-AUG-GCU-GGU-AUU-UGU-UAG-GAU-UCU-UAG-AAA-AUU-GGU-CAU-UGG-UAG 3′

3. For this project I used a variety of resources to translate this code:

CodonTableAminoAcid
4. I used a key for each jelly bean and amino acid
The message is
Mist at a Chasm is Magic as Light
WIN_20170329_23_45_28_ProWIN_20170329_23_45_40_Pro

 

5. And here is the final product

WIN_20170329_23_47_04_ProWIN_20170329_23_45_56_Pro

 

 

Conclusion:

I had a lot of fun making and modeling Protein Synthesis and it really helped me nail the concept down. Since I already took a quiz on translating the DNA sequence ti really helped on the project. I modeled Transcription by creating the mRNA sequence which was pretty easy. I modeled Translation by choosing the correct jelly beans which was hard because I had to look at the codons, find the amino acid, add to the key, poke a hole and push it through.

There are a lot of mutations that could occur, like if I put the wrong jelly bean and these mutations can also occur in humans. Some proteins could be completely messed up but it won’t have a huge impact on Life on Earth because the unaffected DNA code will be passed down. If there is a mutation in the DNA however, then life on Earth will be severely affected because a mutation will be passed down.

Advertisements
Strawberry DNA Extraction

Strawberry DNA Extraction

Recently we had another lab in our Biology class which was very cool. It was a Strawberry DNA extraction Lab.

 

dna-extraction

img_2228

 

This lab was very cool and our teacher decided to postpone the test for it which was great. I saw this lab under the files section of Canvas for a while now and was wondering when we would work on it.

 

During the lab we mashed up a Strawberry and added a buffer which we created to it. The buffer got rid of everything except the DNA. Then we used a gauze and transfers the remains of the Strawberry into a test tube. We added alcohol to the test tube and spun it and DNA came out. Now this lab is very cool because it works for almost any fruit but it works best for Strawberries.

 

During this time we were studying Mitosis and the reason that this ab relates to Mitosis is that Mitosis involves DNA replication and right now we are studying the shape and how DNA gets replicated so this helped a lot.

 

THERE WERE A FEW QUESTIONS ON THE WORKSHEET WHICH I ANSWERED ON THE FILE.

This slideshow requires JavaScript.

Mitosis Lab

Mitosis Lab

mitosis-lab

Recently we have had a lab in our Biology class about Mitosis. Recently we have been talking about Cancer because it is caused when there is no restriction point in the cell cycle. Just a few days ago, we had a lab where we observed plant and animal cells during Mitosis and it was fascinating. I have put my Lab sheet above. I have taken a lot of pictures because there were so many different cells so if you want to see them all here is a link.

https://drive.google.com/open?id=0B3Ms6kR8LvWZNU1CLVVxckZocVU

I learned a lot from this lab and one of the most important was the difference between plant and animal cells dividing. When I was in 6th grade, I took an earth Science course, in 7th a physics based course and in 8th an introduction to Biology course so I have already studied Mitosis. But one thing that I did not know was that there was a difference between plan and animal cell mitosis. I also thought it was very cool how we were able to see how long each part of mitosis took. In my worksheet I calculated it and that really gave me a better idea of mitosis. I also realized how hard it is to determine which cell is in what phase because between interphase and prophase or between metaphase and anaphase it was hard to tell the difference. I really liked this lab because it gave me better insight into the cell cycle and the different phases of Mitosis.

img_2141

Here is a slideshow of 27 different pictures I have taken.

This slideshow requires JavaScript.

Most of the details about the experiment will be in the lab sheet.

What is cancer

What is cancer

Cancer is a very deadly disease that has plagued our society. I personally do not know anybody that has cancer for which I am very grateful.

When I heard the statistics:

1 in 2 men and 1 in 3 women will experience cancer in their lifetimes.
Cancer afflicts 1.7 million Americans each year—and kills 600,000 of them.
40% of cancer cases have no known cause at all.
Cancer mortality has been slowly declining — down 20% over the last two decades.
If society were to implement what’s known about prevention, cancer deaths could be reduced by 50%.

I was shocked! I had no idea so many people got cancer every year and so many people died from it.
It made me really sad that we could save a lot of people from cancer if we implement what we know which makes me question why we haven’t yet.

I recently watched a few videos from PBS about Cancer and I have learned a lot.
http://ca.pbslearningmedia.org/resource/8e81e1ad-e720-4550-b350-11ea5656d7b5/what-is-cancer-lesson-plan/

220px-lung_cancer_cell_during_cell_division-nih

 

1. What is Cancer

The first video talked about cancer and what it was. In the video it said that the Cancer is a genetic disease that causes cells to grow uncontrollably. The growth of these cells can cause tumors and can spread cancer cells throughout the body. Cancer is not only one disease but it is a variety of 1100 diseases and cancer can evolve to prevent from getting cured by medicine. Cancer cells lose their ability to communicate and because of this they have uncontrolled growth. Cancer cells gene mutations can cause it to evolve and not be affected by medicine. Cancer cells are free to flow through the bloodstreams.

 

2. Cancer Treatment Today

Cancer will probably never be cured but we might be  to find a way to control it. New technology has evolved to cause scientists to detect cancer earlier to began treatment. Even though Cancer mutates, most of its mutations are insignificant. and that some genes control cancer cells.When scientists learned this, they could develop better ways to combat cancer. I hope that scientists can find a way to cure cancer and save so many peoples lives and stop the disease of our time in India.

 

3. Why is Cancer so difficult to Cure

One way we could easily solve Cancer is to stop smoking tobacco and stay away from radioactive materials. Another way we can help prevent cancer is to have a healthy diet and stay physical. Eating junk food increases the rate of getting cancer.

 

4. Cancer Treatment Today

Cancer cells are different from normal calls because they mutate and reproduce. Because cancer cells spread so much it is very hard to solve the this dangerous disease. Since the DNA stays the same when cancer cells reproduce it continues to replicate. Because the cancer cells spread so much, it is very hard to cure later so it is best to figure it out early.I hope everyone with cancer can figure out they have it early and not hesitate to get rid of it.

 

5. Future of Cancer Treatment

 

Richard Klausner is trying to say how powerful and dangerous cancer is. How over 3 billion years of evolution has lead to a powerful disease like cancer. To solve cancer we need a better more effective method.

 

6. Evolution in a Bottle

We are told that Cancer is a work of progress, but eventually we will find a cure. Scientists are amazed how much they have learned in a year. There have been cycles of learning have been improving. The way of treating cancer has transformed over the last few decades and they will continue to evolve. If cancer evolves than so will we.Scientists are trying to map each individuals patients cancer, and treat each of them personally. They want a much more individualized approach. Doctors can mix the drugs and form the cure to cancer. Combination targeted therapy might not work because cancer is always evolving and adapting. Cancer is evolution in a bottle. 3 billion years have created the diversity and life and cancer.Cancer is all of the history of life.

 

 

 

 

 

My thoughts about Biology Honors on 12-2-2016

My thoughts about Biology Honors on 12-2-2016

These next few Blogs will be my journal on Biology honors. This will go through this Friday so for a week. This will consist of 5 Blog Reports.

Here are some of my notes for the class. They were quick notes and most of the words are off

glycolosis

Response:

Start of Class

At the start of class, we had a quiz and a teacher evaluation to fill out. I was really worried for the quiz because our quiz was on the electron transfer chain in cellular respiration which is pretty complicated. I first went and did the teacher evaluation. I gave Mr. Wong I pretty high rating because he is mt favorite teacher. While I was doing the evaluation, Mr. Wong said the quiz was easy and so did Sam. I didn’t believe him at first but then I opened the quiz. It is two 5 point essay questions, in 5 minutes. Then I saw the questions, we just had to add pictures. First i found a picture for the Krebs Cycle and then for the Calvin Cycle. I found some good pictures, but then I realized with a minute to go that I had the wrong picture. I quickly switched the picture in time. My friend Jahan wasn’t that lucky. His links were broken and he even mixed up the links. I wish him the best of luck.

Food around the World

We then went into a near pod on Food around the world. We saw families food for the week and we wrote what we thought on their diet. It was really fun and I really liked this activity. Activities like this is why Biology is my favorite class.

Racism

screenshot-37

At this point something terrible happened. There was a picture of a Japanese family and we were supposed to talk about their food. Somebody submitted this as there response and the whole room got tense. Since our Mr. Wong he took offense to this. I know that this was very wrong and even though the person who typed it didn’t mean it but it was very wrong. Our teacher than went into a discussion on racism and how we are stereotyping. It really impacted me because it made me realize the stereotyping in my life. Since I am Indian, lots of students relate me to math or computer science, and they are kind of true because I am taking AP AB Calculus and want to master in computer science, but I dismiss it. I have always faced subtle bullying and racism, but I don’t care and just let it happen. I know now that this is wrong and I should stand up for myself because otherwise I am letting them win.

Krebs Cycle

After this ordeal, we started learning about the Krebs cycle. It was a very stressful situation and I did not like it. I was just trying to comprehend the Krebs and Cycle and it was very hard. I did not like the situation but I saw the truth in it.

I know I should learn about Biology because I like it a lot. I will also be uploading a music video soon on glycolysis.

screenshot-38