A Protein Composed of carbs!

A Protein Composed of carbs!

Today was a fun day in Biology. I got to bring Jelly Beans to class.

The reason for this was because we were making a Jelly Bean Necklace. We did this because it helped us learn about Protein Synthesis. Protein Synthesis starts with DNA. Then Transcription occurs and we get an mRNA strand. That mRNA strand gets translated into amino acids.

 

In the necklace jelly beans are the specific amino acids spelling out a message.

 

  1. I got #29 which is this DNA sequence

DNA Sequence:

3′ TACTAAAGAACCATCTTAATAATCCTAATCACAGTATTAAGATACATCTAA

AGAATCTACCGACCATAAACAATCCTAAGAATCTTTTAACCAGTAACCATC 5′

or more neatly organized for codons

DNA Sequence:

3′ TAC-TAA-AGA-ACC-ATC-TTA-ATA-ATC-CTA-ATC-ACA-GTA-TTA-AGA-TAC-ATC-TAA

AGA-ATC-TAC-CGA-CCA-TAA-ACA-ATC-CTA-AGA-ATC-TTT-TAA-CCA-GTA-ACC-ATC 5′

2. This DNA sequence translates into the mRNA sequence of:

5′ AUGAUUUCUUGGUAGAAUUAUUAGGAUUAGUGUCAUAAUUCUAUGUAGAUU

UCUUAGAUGGCUGGUAUUUGUUAGGAUUCUUAGAAAAUUGGUCAUUGGUAG 3′

or more organized

5′ AUG-AUU-UCU-UGG-UAG-AAU-UAU-UAG-GAU-UAG-UGU-CAU-AAU-UCU-AUG-UAG-AUU

UCU-UAG-AUG-GCU-GGU-AUU-UGU-UAG-GAU-UCU-UAG-AAA-AUU-GGU-CAU-UGG-UAG 3′

3. For this project I used a variety of resources to translate this code:

CodonTableAminoAcid
4. I used a key for each jelly bean and amino acid
The message is
Mist at a Chasm is Magic as Light
WIN_20170329_23_45_28_ProWIN_20170329_23_45_40_Pro

 

5. And here is the final product

WIN_20170329_23_47_04_ProWIN_20170329_23_45_56_Pro

 

 

Conclusion:

I had a lot of fun making and modeling Protein Synthesis and it really helped me nail the concept down. Since I already took a quiz on translating the DNA sequence ti really helped on the project. I modeled Transcription by creating the mRNA sequence which was pretty easy. I modeled Translation by choosing the correct jelly beans which was hard because I had to look at the codons, find the amino acid, add to the key, poke a hole and push it through.

There are a lot of mutations that could occur, like if I put the wrong jelly bean and these mutations can also occur in humans. Some proteins could be completely messed up but it won’t have a huge impact on Life on Earth because the unaffected DNA code will be passed down. If there is a mutation in the DNA however, then life on Earth will be severely affected because a mutation will be passed down.

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s