Eco Bellarmine

Last Thursday we had a very fun lab in our Biology Honors class. It wasn’t technically a lab, but we got to walk around campus and explore the bellarmine campus. I learned a lot about the plants and animals all around campus.

I used my iphone to take pictures all around campus.

Here are my findings.

Producer – Lettuce (Lactuca sativa)

Lettuce is generally found as a garden plant across homes so it is no surprise that we grow it in the Bellarmine garden. Lettuce is commonly used in different types of food and it is found in gardens all over the world. It originated from Asia minor.

IMG_3032

Primary Consumer – Chicken (Gallus gallus domesticus)

Chickens can be found in both the wild and in farms. Chickens can commonly be found on farms in a coop and are usually domesticated for their eggs. Eggs and chickens are also food that a lot of humans eat too. Wild chickens are usually found near shrubs and eat grasses and seed sand lots of different insects. They usually sleep in lower tree branches and eat near the shrubs. They can be found in the Bellarmine Garden.

IMG_3035

Secondary Consumer – Spotted Gecko (Eublepharis macularius)

The Spotted Gecko usually live in the dry deserts and grasslands of south-Asian Afghanistan, Pakistan, north-west India, and some parts of Iran. As with most lizards they live in a dry arid environment. The Spotted Geckos can eat Crickets and since Crickets eat smaller insects, the Spotted Gecko is a secondary consumer. The Spotted Gecko can be found in Mr. Wong’s classroom.IMG_3051

Tertiary Consumer – Humans(Homo Sapiens)

One huge part of the bellarmine ecosystem are humans. Humans can be found all around the Bellarmine campus and all around the world. Humans eat a variety of foods and are tertiary consumers. They can be found all around the world and on every sngle continent.

IMG_3007
Decomposer – Snail(Gastropoda)

Snails are unique because they have adapted to all the habitats on the earth. They can survive in both hot and cold climates. They are usually found in mountainous and high altitude regions. They are essential to an ecosystem because they help recycle nutrients. They can be found all over the bellarmine campu, but this picture shows snails that are on a tree in the quad.

IMG_3052

Herbivore – Pill Bug(Armadillidiidae)

Pill Bugs are commonly found in damp environments like under leaves are in dirt. They sometimes wander around like in this picture. They eat decomposing vegetation.

IMG_3047
Carnivore – Dog(Canis lupus familiaris)

Dogs are usually found in homes because they are commonly pets for humans. This dog is Ms. Giraudo’s dog. His name is Yoshi. Dog’s are domesticated and kept in human homes.

IMG_3044IMG_3043

Omnivore – American Crow (Corvus brachyrhynchos)

Crows live all around the world and nest wherever they can. They will nest wherever they can and forage for food wherever they can. They eat both seeds and insects which make them an omnivore. They live everywhere and do not have one set habitat.

IMG_3066
Threatened species – Ginkgo (Ginkgo biloba)

The Ginkgo tree is usually found in china and is a threatened species. It is the only living species in the division Ginkgophyta. This tree can be found next to Carney.

WIN_20170511_16_50_51_Pro

Endangered species –  Bakersfield cactus (Opuntia basilaris)

The Bakersfield is found in the Mojave, the Anza-Borrego, and the Colorado deserts. It is an endangered species and is protected by the California government. In the farm there is a box for cacti. This Bakersfield cactus is found in that box.

WIN_20170511_17_03_52_Pro
Non-native species – Bees(Apis)

In the Bellarmine garden we have our own bee farm. Bees lives in hives all around the world. Honey bees usually live in tropical climates and forested areas. Bees in that quantity are no native to the Bellarmine campus and have been transported here by humans. It was hard for me to get a good picture because I didn’t want to be stung.

IMG_3026

Pollution source – Cars

One pollution source in the Bellarmine campus are cars. Since this is a school, students come here everyday in a car so cars are a huge source of pollution. The cars create a lot of exhaust and pollute the environment.

IMG_3040

1. Define and differentiate between ecology and environmental science and discuss the Bellarmine campus in the context of both.

Ecology is the relationship between organisms and their environment. Environmental Science is the study of environments in general. Environmental Science is more broad and includes subjects like geology. Environmental Science, however, does not have anything to do with the organisms. The ecology of Bellarmine is very interesting because there are a lot of organisms. The Bellarmine campus provides refuge in buildings for students and provides shade for a lot of animals. The Bellarmine campus also provides habitats for chickens and bees. Bellarmine’s environment also is interesting. The grass is usually muddy and wet because of the sprinklers. There is a also a lot of cool architecture in the buildings, statues and fountains.

2. define and describe any population, community, ecosystem, biome and aquatic zone that you find on campus; and discuss the biotic and abiotic factors that contribute to that ecosystem.

There is a population of chickens and students on campus. Humans are most important population because they appear all over the campus. There is also a community, of students and teachers on campus. There is also a whole ecosystem on the farm outside of campus. The farm has it’s own animals and its own ecosystem. An example of a biome would be the entire Bellarmine campus because it contains multiple ecosystems. There aren’t many aquatic zones on campus, but there are fountains and water sources but they have no biotic factors. In the farm, there are many abiotic and biotic factors. There are chickens, bees, flies, plants and insects, which are all biotic factors. ABiotic factors, include rocks, wood for the treehouse, and water.
3. construct and discuss a food chain, a food web, and an ecological pyramid based on the trophic levels that you observe.

 

Screenshot (111)

This is a common food chain that i created from some of my data. 10% of the energy transfers between trophic levels and because of this, the biomass of the tertiary consumer is less than the producer. This food chain results in the transfer of energy between the species and then the energy is recycled into the environment by the decomposers. This food chain is important because it shows the transfer of energy in the ecosystem.

 

4. investigate and discuss any endangered, threatened, and invasive species on campus.

The Bellarmine campus surprisingly contains threatened, endangered and invasive species. One threatened species is the Ginkgo tree, which grows right outside of Carney. It is over 270 million years old and is the only surviving species from the family Ginkgophyta. It was originally grown in China and has a basis as a medicine.

The Bakersfield cactus is an endangered species on campus. It is grown in the garden on campus. It is illegal to kill the plant because the population is so endangered. It was originally grown in Bakersfield California, but it’s habitat is unprotected. it has a flower that usually blooms during April or May.

Bees are an example of a non native species. Bees, in huge quantities, are not native to the Bellarmine campus. These bees were brought here by humans which makes them  a non native species.

5. define pollution, and describe and discuss the various types that you observe on campus.

There is a lot of pollution all around campus. One main source of pollution is the cars all around campus. Since this is a school, students travel to and from school using cars and this causes a lot of pollution all around campus. These cars cause a lot of pollution. The Bellarmine campus is also really close to the San Jose International Airport. This airport and the planes landing there, causes a lot of pollution. The Bellarmine campus is also right next to a train station. The train which ends up traveling next to the Bellarmine campus also causes a lot of noise and pollution. SInce the Bellarmine campus is full of teenagers, littering plays a big role in the pollution on campus. Since students often forget to throw away trash, the campus becomes more filthy over time.

Advertisements

Goldfish Lab

Last Friday we had a very int resting lab in my Biology class. We had to test the respiration rate of goldfish. This was very interesting because we actually got to interact with live animals. My lab partner and I, tested the respiration rate of goldfish at different temperatures.

 

testHere are our results. The tests resulted in us neglected our hypothesis. We had a high room temperature of 22 degrees Celsius and we lowered it substantially with ice. It was hard to increase the temperature because water has a high specific heat but we got it a few degrees Celsius warmer and tested it. With our 4 fish we realized that the room temperature average was 128 breaths which was good. By taking the average we made sure that our data was accurate.

Screenshot (97)

  1. The fishes respiration rate is obviously affected by the temperature as we can see from the above graph. The higher the temperature the fish’s respiration rate increases while the colder the temperature is, the lower the rate is. This is true because a fish is cold blooded, so it takes on the temperature in the environment. The colder the environment is, the colder the fish is, and the slower respiration occurs.
  2. Their are many other factors that might have affected breathing rate.One of these could be fear or adrenaline which would skew with the breathing rate. With emotions and hormones the breathing rate will change. We tested this hypothesis and saw that the fish breathed much more often when a hand was in the tank.
  3. Our fish respirated less than the average. We should trust the average because it is more accurate. We know the average is more accurate because it takes multiple results into account.
  4. Scientists usually take data and look at the average because it allows them to get the most accurate data. It allows them a way to accurately compile their data. We did this in this experiment to make sure our results were accurate. We also did not have time to test multiple fishes at different times so an average made sure we had accurate data and we did not have to redo the experiment.
  5. We could test to see if light affects respiration. We could test the experiment normally in the light, and then for the other group we could darken the room and see the affect. By looking at goldfish in the dark we could see if light affects respiration.
  6. At the start of the lab we predicted the respiration rate would lower the farther we get away from the room temperature.Our hypothesis was wrong because with a high temperature, the temperature increased and did not decrease.
  7. I already explained this in problem one, but because the fish are cold blooded it’s internal temperature changes depending on the external temperature. The fish reacted this way because when the fish were cold, their metabolic process would slow down and the fish would breathe less. Also cellular processes would slow down so the fish would breath less.
March for Science

March for Science

Yesterday was Earth day. It gave us a chance to care for our common home and learn more about the environment. I spent most of the day doing homework but I still found time to go to one of the many numerous science marches. These science marches were even featured all over the news.

 

IMG_2852IMG_2857IMG_2877

 

 

I went to the science march in Silicon Valley. The main rally was in Cesar Chavez plaza. There was a lot of people with many scientific signs and food trucks. There was even a virtual reality and PlayStation gaming van. There were many different speakers taking about science in the world. While it was good to learn more about science this rally ended up being very political and religious. I saw many signs about Trump or Jesus and I feel that was not to great. There was also a lot of people and I even ended up running into my uncle there. I feel that the science march was a very great opportunity to learn more about science and there were even younger kids being able to present their science projects. This rally gave kids a chance to be exposed to science and learn more about caring for our home on Earth day.

 

I also ran into a lot of other Bellarmine students:

 

A Protein Composed of carbs!

A Protein Composed of carbs!

Today was a fun day in Biology. I got to bring Jelly Beans to class.

The reason for this was because we were making a Jelly Bean Necklace. We did this because it helped us learn about Protein Synthesis. Protein Synthesis starts with DNA. Then Transcription occurs and we get an mRNA strand. That mRNA strand gets translated into amino acids.

 

In the necklace jelly beans are the specific amino acids spelling out a message.

 

  1. I got #29 which is this DNA sequence

DNA Sequence:

3′ TACTAAAGAACCATCTTAATAATCCTAATCACAGTATTAAGATACATCTAA

AGAATCTACCGACCATAAACAATCCTAAGAATCTTTTAACCAGTAACCATC 5′

or more neatly organized for codons

DNA Sequence:

3′ TAC-TAA-AGA-ACC-ATC-TTA-ATA-ATC-CTA-ATC-ACA-GTA-TTA-AGA-TAC-ATC-TAA

AGA-ATC-TAC-CGA-CCA-TAA-ACA-ATC-CTA-AGA-ATC-TTT-TAA-CCA-GTA-ACC-ATC 5′

2. This DNA sequence translates into the mRNA sequence of:

5′ AUGAUUUCUUGGUAGAAUUAUUAGGAUUAGUGUCAUAAUUCUAUGUAGAUU

UCUUAGAUGGCUGGUAUUUGUUAGGAUUCUUAGAAAAUUGGUCAUUGGUAG 3′

or more organized

5′ AUG-AUU-UCU-UGG-UAG-AAU-UAU-UAG-GAU-UAG-UGU-CAU-AAU-UCU-AUG-UAG-AUU

UCU-UAG-AUG-GCU-GGU-AUU-UGU-UAG-GAU-UCU-UAG-AAA-AUU-GGU-CAU-UGG-UAG 3′

3. For this project I used a variety of resources to translate this code:

CodonTableAminoAcid
4. I used a key for each jelly bean and amino acid
The message is
Mist at a Chasm is Magic as Light
WIN_20170329_23_45_28_ProWIN_20170329_23_45_40_Pro

 

5. And here is the final product

WIN_20170329_23_47_04_ProWIN_20170329_23_45_56_Pro

 

 

Conclusion:

I had a lot of fun making and modeling Protein Synthesis and it really helped me nail the concept down. Since I already took a quiz on translating the DNA sequence ti really helped on the project. I modeled Transcription by creating the mRNA sequence which was pretty easy. I modeled Translation by choosing the correct jelly beans which was hard because I had to look at the codons, find the amino acid, add to the key, poke a hole and push it through.

There are a lot of mutations that could occur, like if I put the wrong jelly bean and these mutations can also occur in humans. Some proteins could be completely messed up but it won’t have a huge impact on Life on Earth because the unaffected DNA code will be passed down. If there is a mutation in the DNA however, then life on Earth will be severely affected because a mutation will be passed down.

Meiosis Movie

 

Group: Akash, Tanay, Jahan, and Anish

 

A few months ago we started learning about reproduction. Meiosis was important because it allows us to create gametes like sperm and eggs. Our specific meiosis movie is happening in a male because there is one y chromosome and one x chromosome. In these Y and X chromosomes, crossing over occurs only in Pseudoautosomal regions.  A lot of different materials were used by our group like pipe cleaners or beads. This experiment taught us a lot about meiosis and the different processes. I learned a lot of different things like:

What is the function of meiosis?

The function of meiosis is to create gametes like sperm or egg cells. Through meiosis the number of chromosomes in the parent changes from diploid to haploid. The point of this is when the sperm and egg combine we get a zygote with the correct amount of chromosomes. Without meiosis the zygote will not have the required number of chromosomes.

  • What events promote genetic variation during meiosis?

There are lot of events in meiosis that help genetic variation. There are two ways in which genetic variation occurs. One way is in Prophase 1 when crossing over occurs. This way genes get changed between male and humans. Another way is in Metaphase 1 and 2 when the chromosomes line up. The chromosomes can be lined up in any way or direction so this promotes genetic variation. Additionally any sperm or any egg can combine.

  • What causes non-disjunction?

Non disjunction is an error in meiosis that results in an uneven amount of chromosomes. During Anaphase 1 the homologous chromosomes all go in one way that results in uneven amount of chromosomes. This image sums it up well.

Image result for nondisjunction

  • Panda bears have 42 chromosomes compared to 74 chromosomes found in most bears. How could this occur? Explain in terms of non-disjunction.

Maybe one of the panda bear’s ancestors had a child where non disjunction occurred in meiosis. Maybe the offspring had a lower number of chromosomes because of non disjunction and this led to the panda bear. Maybe non disjunction led to the loss of genetic information, explaining why Panda bears are so much different than other bears.

  • What did you learn from this project?

I learned the specific details of meiosis and what happens during the specific steps. I know what happens during each phase and how genetic variation occurs. I first learned about meiosis a few years ago but it was very confusing then. This project gave me a chance to work with my friends and learn a lot while having fun.

Lunar New Year 2017

Lunar New Year 2017

Just yesterday I attended a Lunar New Year Festival at my school. It was really fun because I learned a lot about Chinese culture. I attended a similar event like this a few months ago when I attended a Diwali Festival at my school.  After I came in, I saw a game where we had to move MNM’s from bowl to bowl with chopsticks which was impossible for me. Then I bought my ticket and looked around. I saw a lot of my friends there and almost every student from the Mandarin classes was there. I also saw a bunch of teachers like the Mandarin teacher, Mr. Yu and my Biology teacher Mr. Wong. I got a selfie with them. Then I went around, talked to my friends and learned how to write Large in Chinese. Then the shows started and I learned a lot about the culture. I saw the dragon dance  and I learned how them spreading Lettuce was the spreading of good luck. There was a lot of different activities and I learned a lot but the favorite thing that I learned was how to properly eat with chopsticks. A lot of my friends also sang two songs in Mandarin which was very entertaining.

 

img_2605

 

This slideshow requires JavaScript.

 

I also wanted to talk about the significance of cultural events to mankind.

We celebrate cultural events because they are related to tradition. It helps us remember who we are and what are ancestors had to go through. It also lets us connect to our culture. There are different festivals that allow us to have fun and celebrate . These celebrations has allowed us to see the evolution. For Chinese New Year in particular, after fireworks were invented things have changed. It allowed us to change how we celebrated and it affected culture.

We can meet up with family and reminisce on tradition or what happened during the past year of the festival. It gives us a chance to be social and interact with friends and family. It also strengthens the sense of community and allows you to connect with people from your country or religion.

Celebrations help us connect with evolution because it lets us see how a certain event has changed over the ages and it is how mankind keeps memories and tradition throughout the ages.

Meeting up with family and friends to celebrate our cultural heritage during celebrations is important and I am very glad I went to the Lunar New Year celebration so that I could learn more about Chinese culture.